AMBAYANLHYNIN AMBAYANLHYNIN

English

Answered

1. Mother has
at the park
A. arriving
B. arrived
C. arrive
D. arrives

Sagot :

АНОНИМIN АНОНИМIN

Answer:

1. Mother has____at the park

A. arriving

B. arrived

C. arrive

D. arrives

B. Arrived

_______________________

#CarryOnLearning

Answer Link

BLYANAIN BLYANAIN

Answer:

1. Mother has

at the park

A. arriving

B. arrived

C. arrive

D. arrives

Mother has arrived at the park

#CarryOnLearning

Answer Link

In Studier: Other Questions

Para Sa Mga Bilang 25-27, Hanapin Ang Bahagi Ng Pangungusap Na Tinutukoy Sa Bawat Bilang. 

I Need To Recharge My Smartphones What Is The Correct Ansewer

II. Choose The Variable In The Given Algebraic Equations. Write Your Answer On The Space Before Each Number. 9.0-3=1 11. 2m +8 = 28 10. 3x + 5 = 14 12. 7b - 5 =

8) One Of The Different Strategies Used In Solving Non-routine Word Problems Is Looking For A ____________Nonsense=Reported

Ano Ang Isyung Panlipunan (kabanata, Ngayon) Sa Noli Me Tangere Kabanata 36

ACTIVITY I_Identity Whether The Statement Is True Or False. Write Your Answer On The Blank Belor number 1. Congruent Polygons Have The Same Shape And Size. 2. T

ACTIVITIES Activity 1 Direction: Test Your Understanding By Answering The Following Questions. Write At Least 3 Sentences. 1. If You Were Able To Prepare A Sand

Patulong Po Sana Ako, Yung With Explanation, Yung Number 33. Lng Po Yung Sagutan,

Pa Help Po Ng Maayos Please Need Lng Ng Pinsan Q [tex]\huge{\color{violet}{\boxed{\color{gold}{nonesense \: Report}}}} [/tex]

Samantha Is Y Years Old Now. Write The Algebraic Equation For Samantha's Age If Her Age 5 Year From Now Is 17

The Sequence Of DNA Is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What Is The Sequence Of The Complimentary RNA Strand?(Pa Help Po Dito Please Pasahan Napo Kasi Mamaya)

Deductive Method Of Reasoning