👤

The sequence of DNA is 5’ ATGCATAGATTAGGATATCCCAGATAG 3’. What is the sequence of the complimentary RNA strand?

(Pa help po, ty in advance)​


The Sequence Of DNA Is 5 ATGCATAGATTAGGATATCCCAGATAG 3 What Is The Sequence Of The Complimentary RNA StrandPa Help Po Ty In Advance class=

Sagot :

Answer:

5′ ATGGTTCCATC 3′

3′ TACCAAGGTAG 5′ is it's complementary DANA strand. But for mRNA transcription from DNA only the strand with polarity from 3′→5′ act as a template & is referred to as template strand, thus the mRNA strand will be :

5′ AUGGUUCCAUC 3′ in mRNA thymine nucleaotide isn't existing rather uracil replaces it & binds with Adenine just lyk thymine.

P.S. when 5′-> 3′ DNA sequence is given, RNA has same sequence of nucleaotide as given DNA except uracil in place of thymine.

Explanation:

According to complimentary base pairing, A pairs with T and C with G. For the given sequence, the complementary strand will be 3'- TACGTACGTACGTACGTACGTACGTACG − 5’. So, the sequence of the complimentary strand in 5' to 3' direction is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3’.