ALDOMARANDOYO25IN ALDOMARANDOYO25IN

Science

Answered

5'TAATGCCGCGCGCGCGCTATATTTGCCG3', give the corresponding daughter strand.

Sagot :

DANIELSERNANDE30IN DANIELSERNANDE30IN

Answer:

Daughter strand

Refers to the newly synthesized strand of DNA that is copied via the addition of complementary nucleotides from one strand of pre-existing DNA during DNA replication.

Answer Link

In Studier: Other Questions

Paano Nakatutulong Ang Ponemang Suprasegmental Sa Pagpapahayag Ng Saloobin, Pagbibigay Ng Kahulugan , Layunin At Intensyon? Ipaliwanag.

What Are The 5 Indigenous Instruments From Latin-american Music?

Paano Makatutulong Ang "upcycling" Sa Kalikasan At Sa Kabuhayan Ng Mga Tao?

Here Are Some Of The Activities Most Boys And Girls Do To Take Care Of His Body Especially During Puberty Stage

7. Have You Taken Videos Of Yourself And Your Friends/ Family? If So, What Devicedo You Use For This?

Question No. 2 What Is The Smallest Three-digit Number Divisible By 3,5 And 20?

Give The Relevance Of The History As The Study Of Discover

Gawain 5Panuto: Inaasahang Masasagot Ang Mga Tanong Tungkol Sa Binasang Posisyong Papel Hinggil Saisyung Pagtanggal Ng Asignaturang Filipino Sa Mga Kolehiyo At

This Is The Knob Used To Move The Body Tube Up And Down For Focusing

Masigla Ang Mga Tao Tuwing Piyesta.Masiglang Sumasayaw Ang Mga Tao Sa Piyesta.Pang-abay O Pang Uri

When Is My Birthday

Leading Professional Image Editing Program.